]> dgit.raspbian.org Git - python-pysam.git/commitdiff
Add back files that were accidentally deleted when merging upstream release.
authorCharles Plessy <plessy@debian.org>
Sat, 19 Apr 2014 02:54:31 +0000 (11:54 +0900)
committerCharles Plessy <plessy@debian.org>
Sat, 19 Apr 2014 02:54:31 +0000 (11:54 +0900)
debian/compat [new file with mode: 0644]
debian/patches/do_not_use_distribute_setup.patch [new file with mode: 0644]
debian/patches/fix_cleanup_tests.patch [new file with mode: 0644]
debian/patches/offline-tests.patch [new file with mode: 0644]
debian/patches/series [new file with mode: 0644]
debian/source/format [new file with mode: 0644]

diff --git a/debian/compat b/debian/compat
new file mode 100644 (file)
index 0000000..ec63514
--- /dev/null
@@ -0,0 +1 @@
+9
diff --git a/debian/patches/do_not_use_distribute_setup.patch b/debian/patches/do_not_use_distribute_setup.patch
new file mode 100644 (file)
index 0000000..fd60f92
--- /dev/null
@@ -0,0 +1,17 @@
+Author: Olivier Sallou <olivier.sallou@irisa.fr>
+Last-Updated: Fri, 07 Feb 2014 18:29:40 +0100
+Description: Prevent downloading distribute_setup
+
+--- pysam.orig/setup.py
++++ pysam/setup.py
+@@ -127,8 +127,8 @@
+ # cp samtools/win32/*.h pysam/include/win32
+-from distribute_setup import use_setuptools
+-use_setuptools()
++#from distribute_setup import use_setuptools
++#use_setuptools()
+ from setuptools import Extension, setup, find_packages
diff --git a/debian/patches/fix_cleanup_tests.patch b/debian/patches/fix_cleanup_tests.patch
new file mode 100644 (file)
index 0000000..178876e
--- /dev/null
@@ -0,0 +1,19 @@
+Author: Andreas Tille <tille@debian.org>
+Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100
+Description: Prevent tests makefile from deleting files which
+ are contained inside the upstream source
+
+--- a/tests/Makefile
++++ b/tests/Makefile
+@@ -47,6 +47,11 @@ example_bai.bam: ex1.bam
+ clean:
++      mkdir keep_bam_files
++      mv ex9_fail.bam ex9_nofail.bam example_btag.bam example_empty_header.bam issue100.bam tag_bug.bam test_unaligned.bam keep_bam_files
+       rm -fr *.bam *.bai *.fai *.pileup* \
+               *~ calDepth *.dSYM pysam_*.sam \
+       ex2.sam ex2.sam.gz ex1.sam
++      mv keep_bam_files/* .
++      rmdir keep_bam_files
++      rm -rf pysam_test_work/
diff --git a/debian/patches/offline-tests.patch b/debian/patches/offline-tests.patch
new file mode 100644 (file)
index 0000000..968b5ba
--- /dev/null
@@ -0,0 +1,1824 @@
+Author: Andreas Tille <tille@debian.org>
+Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100
+Description: Create a copy of the test suite script and remove those
+ tests that try to fetch files from network
+
+--- /dev/null
++++ b/tests/pysam_test_offline.py
+@@ -0,0 +1,1816 @@
++#!/usr/bin/env python
++'''unit testing code for pysam.
++
++Execute in the :file:`tests` directory as it requires the Makefile
++and data files located there.
++'''
++
++import pysam
++import unittest
++import os, re, sys
++import itertools
++import collections
++import subprocess
++import shutil
++import logging
++
++IS_PYTHON3 = sys.version_info[0] >= 3
++
++if IS_PYTHON3:
++    from itertools import zip_longest
++else:
++    from itertools import izip as zip_longest
++
++
++SAMTOOLS="samtools"
++WORKDIR="pysam_test_work"
++
++def checkBinaryEqual( filename1, filename2 ):
++    '''return true if the two files are binary equal.'''
++    if os.path.getsize( filename1 ) !=  os.path.getsize( filename2 ):
++        return False
++
++    infile1 = open(filename1, "rb")
++    infile2 = open(filename2, "rb")
++
++    def chariter( infile ):
++        while 1:
++            c = infile.read(1)
++            if c == b"": break
++            yield c
++
++    found = False
++    for c1,c2 in zip_longest( chariter( infile1), chariter( infile2) ):
++        if c1 != c2: break
++    else:
++        found = True
++
++    infile1.close()
++    infile2.close()
++    return found
++
++def runSamtools( cmd ):
++    '''run a samtools command'''
++
++    try:
++        retcode = subprocess.call(cmd, shell=True,
++                                  stderr = subprocess.PIPE)
++        if retcode < 0:
++            print("Child was terminated by signal", -retcode)
++    except OSError as e:
++        print("Execution failed:", e)
++
++def getSamtoolsVersion():
++    '''return samtools version'''
++
++    with subprocess.Popen(SAMTOOLS, shell=True, stderr=subprocess.PIPE).stderr as pipe:
++        lines = b"".join(pipe.readlines())
++
++    if IS_PYTHON3:
++        lines = lines.decode('ascii')
++    return re.search( "Version:\s+(\S+)", lines).groups()[0]
++
++class BinaryTest(unittest.TestCase):
++    '''test samtools command line commands and compare
++    against pysam commands.
++
++    Tests fail, if the output is not binary identical.
++    '''
++
++    first_time = True
++
++    # a dictionary of commands to test
++    # first entry: (samtools output file, samtools command)
++    # second entry: (pysam output file, (pysam function, pysam options) )
++    commands = \
++        { 
++          "view" :
++              (
++                ("ex1.view", "view ex1.bam > ex1.view"),
++                ("pysam_ex1.view", (pysam.view, "ex1.bam" ) ),
++                ),
++          "view2" :
++              (
++                ("ex1.view", "view -bT ex1.fa -o ex1.view2 ex1.sam"),
++                # note that -o ex1.view2 throws exception.
++                ("pysam_ex1.view", (pysam.view, "-bT ex1.fa -oex1.view2 ex1.sam" ) ),
++                ),
++          "sort" :
++              (
++                ( "ex1.sort.bam", "sort ex1.bam ex1.sort" ),
++                ( "pysam_ex1.sort.bam", (pysam.sort, "ex1.bam pysam_ex1.sort" ) ),
++                ),
++          "mpileup" :
++              (
++                ("ex1.pileup", "mpileup ex1.bam > ex1.pileup" ),
++                ("pysam_ex1.mpileup", (pysam.mpileup, "ex1.bam" ) ),
++                ),
++          "depth" :
++              (
++                ("ex1.depth", "depth ex1.bam > ex1.depth" ),
++                ("pysam_ex1.depth", (pysam.depth, "ex1.bam" ) ),
++                ),
++          "faidx" : 
++              ( 
++                ("ex1.fa.fai", "faidx ex1.fa"), 
++                ("pysam_ex1.fa.fai", (pysam.faidx, "ex1.fa") ),
++                ),
++          "index":
++              (
++                ("ex1.bam.bai", "index ex1.bam" ),
++                ("pysam_ex1.bam.bai", (pysam.index, "pysam_ex1.bam" ) ),
++                ),
++          "idxstats" :
++              ( 
++                ("ex1.idxstats", "idxstats ex1.bam > ex1.idxstats" ),
++                ("pysam_ex1.idxstats", (pysam.idxstats, "pysam_ex1.bam" ) ),
++                ),
++          "fixmate" :
++              (
++                ("ex1.fixmate", "fixmate ex1.bam ex1.fixmate" ),
++                ("pysam_ex1.fixmate", (pysam.fixmate, "pysam_ex1.bam pysam_ex1.fixmate") ),
++                ),
++          "flagstat" :
++              (
++                ("ex1.flagstat", "flagstat ex1.bam > ex1.flagstat" ),
++                ("pysam_ex1.flagstat", (pysam.flagstat, "pysam_ex1.bam") ),
++                ),
++          "calmd" :
++              (
++                ("ex1.calmd", "calmd ex1.bam ex1.fa > ex1.calmd" ),
++                ("pysam_ex1.calmd", (pysam.calmd, "pysam_ex1.bam ex1.fa") ),
++                ),
++          "merge" :
++              (
++                ("ex1.merge", "merge -f ex1.merge ex1.bam ex1.bam" ),
++                # -f option does not work - following command will cause the subsequent
++                # command to fail
++                ("pysam_ex1.merge", (pysam.merge, "pysam_ex1.merge pysam_ex1.bam pysam_ex1.bam") ),
++                ),
++          "rmdup" :
++              (
++                ("ex1.rmdup", "rmdup ex1.bam ex1.rmdup" ),
++                ("pysam_ex1.rmdup", (pysam.rmdup, "pysam_ex1.bam pysam_ex1.rmdup" )),
++                ),
++          "reheader" :
++              (
++                ( "ex1.reheader", "reheader ex1.bam ex1.bam > ex1.reheader"),
++                ( "pysam_ex1.reheader", (pysam.reheader, "ex1.bam ex1.bam" ) ),
++                ),
++          "cat":
++              (
++                ( "ex1.cat", "cat ex1.bam ex1.bam > ex1.cat"),
++                ( "pysam_ex1.cat", (pysam.cat, "ex1.bam ex1.bam" ) ),
++                ),
++          "targetcut":
++              (
++                ("ex1.targetcut", "targetcut ex1.bam > ex1.targetcut" ),
++                ("pysam_ex1.targetcut", (pysam.targetcut, "pysam_ex1.bam") ),
++                ),
++          "phase":
++              (
++                ("ex1.phase", "phase ex1.bam > ex1.phase" ),
++                ("pysam_ex1.phase", (pysam.phase, "pysam_ex1.bam") ),
++                ),
++          "import" :
++              (
++                ("ex1.bam", "import ex1.fa.fai ex1.sam.gz ex1.bam" ),
++                ("pysam_ex1.bam", (pysam.samimport, "ex1.fa.fai ex1.sam.gz pysam_ex1.bam") ),
++                ),
++          "bam2fq":
++              (
++                ("ex1.bam2fq", "bam2fq ex1.bam > ex1.bam2fq" ),
++                ("pysam_ex1.bam2fq", (pysam.bam2fq, "pysam_ex1.bam") ),
++                ),
++          "pad2unpad":
++              (
++                ("ex2.unpad", "pad2unpad -T ex1.fa ex2.bam > ex2.unpad" ),
++                ("pysam_ex2.unpad", (pysam.pad2unpad, "-T ex1.fa ex2.bam") ),
++                ),
++          "bamshuf":
++              (
++                ("ex1.bamshuf.bam", "bamshuf ex1.bam ex1.bamshuf" ),
++                ("pysam_ex1.bamshuf.bam", (pysam.bamshuf, "ex1.bam pysam_ex1.bamshuf") ),
++                ),
++          "bedcov":
++              (
++                ("ex1.bedcov", "bedcov ex1.bed ex1.bam > ex1.bedcov" ),
++                ("pysam_ex1.bedcov", (pysam.bedcov, "ex1.bed ex1.bam") ),
++                ),
++        }
++
++    # some tests depend on others. The order specifies in which order
++    # the samtools commands are executed.
++    # The first three (faidx, import, index) need to be in that order, 
++    # the rest is arbitrary.
++    order = ('faidx', 'import', 'index', 
++             # 'pileup1', 'pileup2', deprecated
++             # 'glfview', deprecated
++             'view', 'view2',
++             'sort',
++             'mpileup',
++             'depth',
++             'idxstats',
++             'fixmate',
++             'flagstat',
++              ## 'calmd',
++             'merge',
++             'rmdup',
++             'reheader',
++             'cat',
++             'bedcov',
++             'targetcut',
++             'phase',
++             'bamshuf',
++             'bam2fq',
++              'pad2unpad',
++              )
++
++    def setUp( self ):
++        '''setup tests. 
++
++        For setup, all commands will be run before the first test is
++        executed. Individual tests will then just compare the output
++        files.
++        '''
++        if BinaryTest.first_time:
++
++            # remove previous files
++            if os.path.exists( WORKDIR ):
++                shutil.rmtree( WORKDIR )
++                pass
++
++            # copy the source files to WORKDIR
++            os.makedirs( WORKDIR )
++
++            shutil.copy( "ex1.fa", os.path.join( WORKDIR, "pysam_ex1.fa" ) )
++            shutil.copy( "ex1.fa", os.path.join( WORKDIR, "ex1.fa" ) )
++            shutil.copy( "ex1.sam.gz", os.path.join( WORKDIR, "ex1.sam.gz" ) )
++            shutil.copy( "ex1.sam", os.path.join( WORKDIR, "ex1.sam" ) )
++            shutil.copy( "ex2.bam", os.path.join( WORKDIR, "ex2.bam" ) )
++
++            # cd to workdir
++            savedir = os.getcwd()
++            os.chdir( WORKDIR )
++            
++            for label in self.order:
++                # print ("command=", label)
++                command = self.commands[label]
++                # build samtools command and target and run
++                samtools_target, samtools_command = command[0]
++                runSamtools( " ".join( (SAMTOOLS, samtools_command )))
++
++                # get pysam command and run
++                try:
++                    pysam_target, pysam_command = command[1]
++                except ValueError as msg:
++                    raise ValueError( "error while setting up %s=%s: %s" %\
++                                          (label, command, msg) )
++
++                pysam_method, pysam_options = pysam_command
++                try:
++                    output = pysam_method( *pysam_options.split(" "), raw=True)
++                except pysam.SamtoolsError as msg:
++                    raise pysam.SamtoolsError( "error while executing %s: options=%s: msg=%s" %\
++                                                   (label, pysam_options, msg) )
++
++                
++                if ">" in samtools_command:
++                    with open( pysam_target, "wb" ) as outfile:
++                        if type(output) == list:
++                            if IS_PYTHON3:
++                                for line in output: 
++                                    outfile.write( line.encode('ascii') )
++                            else:
++                                for line in output: outfile.write( line )
++                        else:
++                            outfile.write(output)
++
++            os.chdir( savedir )
++            BinaryTest.first_time = False
++
++        samtools_version = getSamtoolsVersion()
++
++        
++        def _r( s ):
++            # patch - remove any of the alpha/beta suffixes, i.e., 0.1.12a -> 0.1.12
++            if s.count('-') > 0: s = s[0:s.find('-')]
++            return re.sub( "[^0-9.]", "", s )
++
++        if _r(samtools_version) != _r( pysam.__samtools_version__):
++            raise ValueError("versions of pysam/samtools and samtools differ: %s != %s" % \
++                                 (pysam.__samtools_version__,
++                                  samtools_version ))
++
++    def checkCommand( self, command ):
++        if command:
++            samtools_target, pysam_target = self.commands[command][0][0], self.commands[command][1][0]
++            samtools_target = os.path.join( WORKDIR, samtools_target )
++            pysam_target = os.path.join( WORKDIR, pysam_target )
++            self.assertTrue( checkBinaryEqual( samtools_target, pysam_target ), 
++                             "%s failed: files %s and %s are not the same" % (command, samtools_target, pysam_target) )
++            
++    def testImport( self ):
++        self.checkCommand( "import" )
++
++    def testIndex( self ):
++        self.checkCommand( "index" )
++
++    def testSort( self ):
++        self.checkCommand( "sort" )
++
++    def testMpileup( self ):
++        self.checkCommand( "mpileup" )
++
++    def testDepth( self ):
++        self.checkCommand( "depth" )
++
++    def testIdxstats( self ):
++        self.checkCommand( "idxstats" )
++
++    def testFixmate( self ):
++        self.checkCommand( "fixmate" )
++
++    def testFlagstat( self ):
++        self.checkCommand( "flagstat" )
++        
++    def testMerge( self ):
++        self.checkCommand( "merge" )
++
++    def testRmdup( self ):
++        self.checkCommand( "rmdup" )
++
++    def testReheader( self ):
++        self.checkCommand( "reheader" )
++
++    def testCat( self ):
++        self.checkCommand( "cat" )
++
++    def testTargetcut( self ):
++        self.checkCommand( "targetcut" )
++
++    def testPhase( self ):
++        self.checkCommand( "phase" )
++
++    def testBam2fq( self ):
++        self.checkCommand( "bam2fq" )
++
++    def testBedcov( self ):
++        self.checkCommand( "bedcov" )
++
++    def testBamshuf( self ):
++        self.checkCommand( "bamshuf" )
++
++    def testPad2Unpad( self ):
++        self.checkCommand( "pad2unpad" )
++
++    # def testPileup1( self ):
++    #     self.checkCommand( "pileup1" )
++    
++    # def testPileup2( self ):
++    #     self.checkCommand( "pileup2" )
++
++    # deprecated
++    # def testGLFView( self ):
++    #     self.checkCommand( "glfview" )
++
++    def testView( self ):
++        self.checkCommand( "view" )
++
++    def testEmptyIndex( self ):
++        self.assertRaises( IOError, pysam.index, "exdoesntexist.bam" )
++
++    def __del__(self):
++        if os.path.exists( WORKDIR ):
++            pass
++        # shutil.rmtree( WORKDIR )
++
++class IOTest(unittest.TestCase):
++    '''check if reading samfile and writing a samfile are consistent.'''
++
++    def checkEcho( self, input_filename, 
++                   reference_filename, 
++                   output_filename, 
++                   input_mode, output_mode, use_template = True ):
++        '''iterate through *input_filename* writing to *output_filename* and
++        comparing the output to *reference_filename*. 
++        
++        The files are opened according to the *input_mode* and *output_mode*.
++
++        If *use_template* is set, the header is copied from infile using the
++        template mechanism, otherwise target names and lengths are passed 
++        explicitely. 
++
++        '''
++
++        infile = pysam.Samfile( input_filename, input_mode )
++        if use_template:
++            outfile = pysam.Samfile( output_filename, output_mode, template = infile )
++        else:
++            outfile = pysam.Samfile( output_filename, output_mode, 
++                                     referencenames = infile.references,
++                                     referencelengths = infile.lengths,
++                                     add_sq_text = False )
++            
++        iter = infile.fetch()
++
++        for x in iter: outfile.write( x )
++        infile.close()
++        outfile.close()
++
++        self.assertTrue( checkBinaryEqual( reference_filename, output_filename), 
++                         "files %s and %s are not the same" % (reference_filename, output_filename) )
++
++
++    def testReadWriteBam( self ):
++        
++        input_filename = "ex1.bam"
++        output_filename = "pysam_ex1.bam"
++        reference_filename = "ex1.bam"
++
++        self.checkEcho( input_filename, reference_filename, output_filename,
++                        "rb", "wb" )
++
++    def testReadWriteBamWithTargetNames( self ):
++        
++        input_filename = "ex1.bam"
++        output_filename = "pysam_ex1.bam"
++        reference_filename = "ex1.bam"
++
++        self.checkEcho( input_filename, reference_filename, output_filename,
++                        "rb", "wb", use_template = False )
++
++    def testReadWriteSamWithHeader( self ):
++        
++        input_filename = "ex2.sam"
++        output_filename = "pysam_ex2.sam"
++        reference_filename = "ex2.sam"
++
++        self.checkEcho( input_filename, reference_filename, output_filename,
++                        "r", "wh" )
++
++    def testReadWriteSamWithoutHeader( self ):
++        
++        input_filename = "ex2.sam"
++        output_filename = "pysam_ex2.sam"
++        reference_filename = "ex1.sam"
++
++        self.checkEcho( input_filename, reference_filename, output_filename,
++                        "r", "w" )
++
++    def testReadSamWithoutTargetNames( self ):
++        '''see issue 104.'''
++        input_filename = "example_unmapped_reads_no_sq.sam"
++
++        # raise exception in default mode
++        self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++        # raise exception if no SQ files
++        self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++                           check_header = True)
++
++        infile = pysam.Samfile( input_filename, check_header = False, check_sq = False )
++        result = list(infile.fetch())
++
++    def testReadBamWithoutTargetNames( self ):
++        '''see issue 104.'''
++        input_filename = "example_unmapped_reads_no_sq.bam"
++
++        # raise exception in default mode
++        self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++        # raise exception if no SQ files
++        self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++                           check_header = True)
++
++
++        infile = pysam.Samfile( input_filename, check_header = False, check_sq = False )
++        result = list(infile.fetch( until_eof = True))
++
++    def testReadSamWithoutHeader( self ):
++        input_filename = "ex1.sam"
++        output_filename = "pysam_ex1.sam"
++        reference_filename = "ex1.sam"
++
++        # reading from a samfile without header is not implemented.
++        self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++
++        self.assertRaises( ValueError, pysam.Samfile, input_filename, "r",
++                           check_header = False )
++
++    def testReadUnformattedFile( self ):
++        '''test reading from a file that is not bam/sam formatted'''
++        input_filename = "example.vcf40"
++
++        # bam - file raise error
++        self.assertRaises( ValueError, pysam.Samfile, input_filename, "rb" )
++
++        # sam - file error, but can't fetch
++        self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" )
++        
++        self.assertRaises( ValueError, pysam.Samfile, input_filename, "r", 
++                           check_header = False)
++
++    def testBAMWithoutAlignedReads( self ):
++        '''see issue 117'''
++        input_filename = "test_unaligned.bam"
++        samfile = pysam.Samfile( input_filename, "rb", check_sq = False )
++        samfile.fetch( until_eof = True )
++
++    def testBAMWithShortBAI( self ):
++        '''see issue 116'''
++        input_filename = "example_bai.bam"
++        samfile = pysam.Samfile( input_filename, "rb", check_sq = False )
++        samfile.fetch( 'chr2' )
++
++    def testFetchFromClosedFile( self ):
++
++        samfile = pysam.Samfile( "ex1.bam", "rb" )
++        samfile.close()
++        self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120)
++
++    def testClosedFile( self ):
++        '''test that access to a closed samfile raises ValueError.'''
++
++        samfile = pysam.Samfile( "ex1.bam", "rb" )
++        samfile.close()
++        self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120)
++        self.assertRaises( ValueError, samfile.pileup, 'chr1', 100, 120)
++        self.assertRaises( ValueError, samfile.getrname, 0 )
++        self.assertRaises( ValueError, samfile.tell )
++        self.assertRaises( ValueError, samfile.seek, 0 )
++        self.assertRaises( ValueError, getattr, samfile, "nreferences" )
++        self.assertRaises( ValueError, getattr, samfile, "references" )
++        self.assertRaises( ValueError, getattr, samfile, "lengths" )
++        self.assertRaises( ValueError, getattr, samfile, "text" )
++        self.assertRaises( ValueError, getattr, samfile, "header" )
++
++        # write on closed file 
++        self.assertEqual( 0, samfile.write(None) )
++
++    def testAutoDetection( self ):
++        '''test if autodetection works.'''
++
++        samfile = pysam.Samfile( "ex3.sam" )
++        self.assertRaises( ValueError, samfile.fetch, 'chr1' )
++        samfile.close()
++
++        samfile = pysam.Samfile( "ex3.bam" )
++        samfile.fetch('chr1')
++        samfile.close()
++
++    def testReadingFromSamFileWithoutHeader( self ):
++        '''read from samfile without header.
++        '''
++        samfile = pysam.Samfile( "ex7.sam", check_header = False, check_sq = False )
++        self.assertRaises( NotImplementedError, samfile.__iter__ )
++
++    def testReadingFromFileWithoutIndex( self ):
++        '''read from bam file without index.'''
++
++        assert not os.path.exists( "ex2.bam.bai" )
++        samfile = pysam.Samfile( "ex2.bam", "rb" )
++        self.assertRaises( ValueError, samfile.fetch )
++        self.assertEqual( len(list( samfile.fetch(until_eof = True) )), 3270 )
++
++    def testReadingUniversalFileMode( self ):
++        '''read from samfile without header.
++        '''
++
++        input_filename = "ex2.sam"
++        output_filename = "pysam_ex2.sam"
++        reference_filename = "ex1.sam"
++
++        self.checkEcho( input_filename, reference_filename, output_filename,
++                        "rU", "w" )
++
++class TestFloatTagBug( unittest.TestCase ):
++    '''see issue 71'''
++
++    def testFloatTagBug( self ): 
++        '''a float tag before another exposed a parsing bug in bam_aux_get.
++
++        Fixed in 0.1.19
++        '''
++        samfile = pysam.Samfile("tag_bug.bam")
++        read = next(samfile.fetch(until_eof=True))
++        self.assertTrue( ('XC',1) in read.tags )
++        self.assertEqual(read.opt('XC'), 1)
++
++class TestLargeFieldBug( unittest.TestCase ):
++    '''see issue 100'''
++
++    def testLargeFileBug( self ): 
++        '''when creating a read with a large entry in the tag field
++        causes an errror:
++            NotImplementedError: tags field too large
++        '''
++        samfile = pysam.Samfile("issue100.bam")
++        read = next(samfile.fetch(until_eof=True))
++        new_read = pysam.AlignedRead()
++        new_read.tags = read.tags
++        self.assertEqual( new_read.tags, read.tags )
++
++class TestTagParsing( unittest.TestCase ):
++    '''tests checking the accuracy of tag setting and retrieval.'''
++
++    def makeRead( self ):
++        a = pysam.AlignedRead()
++        a.qname = "read_12345"
++        a.tid = 0
++        a.seq="ACGT" * 3
++        a.flag = 0
++        a.rname = 0
++        a.pos = 1
++        a.mapq = 20
++        a.cigar = ( (0,10), (2,1), (0,25) )
++        a.mrnm = 0
++        a.mpos=200
++        a.isize = 0
++        a.qual ="1234" * 3
++        # todo: create tags
++        return a
++
++    def testNegativeIntegers( self ):
++        x = -2
++        aligned_read = self.makeRead()
++        aligned_read.tags = [("XD", int(x) ) ]
++        # print (aligned_read.tags)
++
++    def testNegativeIntegers2( self ):
++        x = -2
++        r = self.makeRead()
++        r.tags = [("XD", int(x) ) ]
++        outfile = pysam.Samfile( "test.bam",
++                                 "wb",
++                                 referencenames = ("chr1",),
++                                 referencelengths = (1000,) )
++        outfile.write (r )
++        outfile.close()
++
++    def testCigarString( self ):
++        r = self.makeRead()
++        self.assertEqual( r.cigarstring, "10M1D25M" )
++        r.cigarstring = "20M10D20M"
++        self.assertEqual( r.cigar, [(0,20), (2,10), (0,20)])
++
++    def testLongTags( self ):
++        '''see issue 115'''
++        
++        r = self.makeRead()
++        rg = 'HS2000-899_199.L3'
++        tags = [('XC', 85), ('XT', 'M'), ('NM', 5), ('SM', 29), ('AM', 29), ('XM', 1), ('XO', 1), ('XG', 4), ('MD', '37^ACCC29T18'), ('XA','5,+11707,36M1I48M,2;21,-48119779,46M1I38M,2;hs37d5,-10060835,40M1D45M,3;5,+11508,36M1I48M,3;hs37d5,+6743812,36M1I48M,3;19,-59118894,46M1I38M,3;4,-191044002,6M1I78M,3;')]
++
++        r.tags = tags
++        r.tags += [("RG",rg)] * 100
++        tags += [("RG",rg)] * 100
++        
++        self.assertEqual( tags, r.tags )
++
++class TestIteratorRow(unittest.TestCase):
++
++    def setUp(self):
++        self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++    def checkRange( self, rnge ):
++        '''compare results from iterator with those from samtools.'''
++        ps = list(self.samfile.fetch(region=rnge))
++        sa = list(pysam.view( "ex1.bam", rnge, raw = True) )
++        self.assertEqual( len(ps), len(sa), "unequal number of results for range %s: %i != %i" % (rnge, len(ps), len(sa) ))
++        # check if the same reads are returned and in the same order
++        for line, (a, b) in enumerate( list(zip( ps, sa )) ):
++            d = b.split("\t")
++            self.assertEqual( a.qname, d[0], "line %i: read id mismatch: %s != %s" % (line, a.rname, d[0]) )
++            self.assertEqual( a.pos, int(d[3])-1, "line %i: read position mismatch: %s != %s, \n%s\n%s\n" % \
++                                  (line, a.pos, int(d[3])-1,
++                                   str(a), str(d) ) )
++            if sys.version_info[0] < 3:
++                qual = d[10]
++            else:
++                qual = d[10].encode('ascii')
++            self.assertEqual( a.qual, qual, "line %i: quality mismatch: %s != %s, \n%s\n%s\n" % \
++                                  (line, a.qual, qual,
++                                   str(a), str(d) ) )
++
++    def testIteratePerContig(self):
++        '''check random access per contig'''
++        for contig in self.samfile.references:
++            self.checkRange( contig )
++
++    def testIterateRanges(self):
++        '''check random access per range'''
++        for contig, length in zip(self.samfile.references, self.samfile.lengths):
++            for start in range( 1, length, 90):
++                self.checkRange( "%s:%i-%i" % (contig, start, start + 90) ) # this includes empty ranges
++
++    def tearDown(self):
++        self.samfile.close()
++
++
++class TestIteratorRowAll(unittest.TestCase):
++
++    def setUp(self):
++        self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++    def testIterate(self):
++        '''compare results from iterator with those from samtools.'''
++        ps = list(self.samfile.fetch())
++        sa = list(pysam.view( "ex1.bam", raw = True) )
++        self.assertEqual( len(ps), len(sa), "unequal number of results: %i != %i" % (len(ps), len(sa) ))
++        # check if the same reads are returned
++        for line, pair in enumerate( list(zip( ps, sa )) ):
++            data = pair[1].split("\t")
++            self.assertEqual( pair[0].qname, data[0], "read id mismatch in line %i: %s != %s" % (line, pair[0].rname, data[0]) )
++
++    def tearDown(self):
++        self.samfile.close()
++
++class TestIteratorColumn(unittest.TestCase):
++    '''test iterator column against contents of ex4.bam.'''
++    
++    # note that samfile contains 1-based coordinates
++    # 1D means deletion with respect to reference sequence
++    # 
++    mCoverages = { 'chr1' : [ 0 ] * 20 + [1] * 36 + [0] * (100 - 20 -35 ),
++                   'chr2' : [ 0 ] * 20 + [1] * 35 + [0] * (100 - 20 -35 ),
++                   }
++
++    def setUp(self):
++        self.samfile=pysam.Samfile( "ex4.bam","rb" )
++
++    def checkRange( self, contig, start = None, end = None, truncate = False ):
++        '''compare results from iterator with those from samtools.'''
++        # check if the same reads are returned and in the same order
++        for column in self.samfile.pileup(contig, start, end, truncate = truncate):
++            if truncate:
++                self.assertGreaterEqual( column.pos, start )
++                self.assertLess( column.pos, end )
++            thiscov = len(column.pileups)
++            refcov = self.mCoverages[self.samfile.getrname(column.tid)][column.pos]
++            self.assertEqual( thiscov, refcov, "wrong coverage at pos %s:%i %i should be %i" % (self.samfile.getrname(column.tid), column.pos, thiscov, refcov))
++
++    def testIterateAll(self):
++        '''check random access per contig'''
++        self.checkRange( None )
++
++    def testIteratePerContig(self):
++        '''check random access per contig'''
++        for contig in self.samfile.references:
++            self.checkRange( contig )
++
++    def testIterateRanges(self):
++        '''check random access per range'''
++        for contig, length in zip(self.samfile.references, self.samfile.lengths):
++            for start in range( 1, length, 90):
++                self.checkRange( contig, start, start + 90 ) # this includes empty ranges
++
++    def testInverse( self ):
++        '''test the inverse, is point-wise pileup accurate.'''
++        for contig, refseq in list(self.mCoverages.items()):
++            refcolumns = sum(refseq)
++            for pos, refcov in enumerate( refseq ):
++                columns = list(self.samfile.pileup( contig, pos, pos+1) )
++                if refcov == 0:
++                    # if no read, no coverage
++                    self.assertEqual( len(columns), refcov, "wrong number of pileup columns returned for position %s:%i, %i should be %i" %(contig,pos,len(columns), refcov) )
++                elif refcov == 1:
++                    # one read, all columns of the read are returned
++                    self.assertEqual( len(columns), refcolumns, "pileup incomplete at position %i: got %i, expected %i " %\
++                                          (pos, len(columns), refcolumns))
++
++    def testIterateTruncate( self ):
++        '''check random access per range'''
++        for contig, length in zip(self.samfile.references, self.samfile.lengths):
++            for start in range( 1, length, 90):
++                self.checkRange( contig, start, start + 90, truncate = True ) # this includes empty ranges
++                
++    def tearDown(self):
++        self.samfile.close()
++
++class TestIteratorColumn2(unittest.TestCase):
++    '''test iterator column against contents of ex1.bam.'''
++
++    def setUp(self):
++        self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++    def testStart( self ):
++        #print self.samfile.fetch().next().pos
++        #print self.samfile.pileup().next().pos
++        pass
++
++    def testTruncate( self ):
++        '''see issue 107.'''
++        # note that ranges in regions start from 1
++        p = self.samfile.pileup(region='chr1:170:172', truncate=True)
++        columns = [ x.pos for x in p ]
++        self.assertEqual( len(columns), 3)
++        self.assertEqual( columns, [169,170,171] )
++
++        p = self.samfile.pileup( 'chr1', 169, 172, truncate=True)
++        columns = [ x.pos for x in p ]
++    
++        self.assertEqual( len(columns), 3)
++        self.assertEqual( columns, [169,170,171] )
++
++class TestAlignedReadFromBam(unittest.TestCase):
++
++    def setUp(self):
++        self.samfile=pysam.Samfile( "ex3.bam","rb" )
++        self.reads=list(self.samfile.fetch())
++
++    def testARqname(self):
++        self.assertEqual( self.reads[0].qname, "read_28833_29006_6945", "read name mismatch in read 1: %s != %s" % (self.reads[0].qname, "read_28833_29006_6945") )
++        self.assertEqual( self.reads[1].qname, "read_28701_28881_323b", "read name mismatch in read 2: %s != %s" % (self.reads[1].qname, "read_28701_28881_323b") )
++
++    def testARflag(self):
++        self.assertEqual( self.reads[0].flag, 99, "flag mismatch in read 1: %s != %s" % (self.reads[0].flag, 99) )
++        self.assertEqual( self.reads[1].flag, 147, "flag mismatch in read 2: %s != %s" % (self.reads[1].flag, 147) )
++
++    def testARrname(self):
++        self.assertEqual( self.reads[0].rname, 0, "chromosome/target id mismatch in read 1: %s != %s" % (self.reads[0].rname, 0) )
++        self.assertEqual( self.reads[1].rname, 1, "chromosome/target id mismatch in read 2: %s != %s" % (self.reads[1].rname, 1) )
++
++    def testARpos(self):
++        self.assertEqual( self.reads[0].pos, 33-1, "mapping position mismatch in read 1: %s != %s" % (self.reads[0].pos, 33-1) )
++        self.assertEqual( self.reads[1].pos, 88-1, "mapping position mismatch in read 2: %s != %s" % (self.reads[1].pos, 88-1) )
++
++    def testARmapq(self):
++        self.assertEqual( self.reads[0].mapq, 20, "mapping quality mismatch in read 1: %s != %s" % (self.reads[0].mapq, 20) )
++        self.assertEqual( self.reads[1].mapq, 30, "mapping quality mismatch in read 2: %s != %s" % (self.reads[1].mapq, 30) )
++
++    def testARcigar(self):
++        self.assertEqual( self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)], "read name length mismatch in read 1: %s != %s" % (self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)]) )
++        self.assertEqual( self.reads[1].cigar, [(0, 35)], "read name length mismatch in read 2: %s != %s" % (self.reads[1].cigar, [(0, 35)]) )
++
++    def testARcigarstring(self):
++        self.assertEqual( self.reads[0].cigarstring, '10M1D25M' )
++        self.assertEqual( self.reads[1].cigarstring, '35M' )
++
++    def testARmrnm(self):
++        self.assertEqual( self.reads[0].mrnm, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].mrnm, 0) )
++        self.assertEqual( self.reads[1].mrnm, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].mrnm, 1) )
++        self.assertEqual( self.reads[0].rnext, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].rnext, 0) )
++        self.assertEqual( self.reads[1].rnext, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].rnext, 1) )
++
++    def testARmpos(self):
++        self.assertEqual( self.reads[0].mpos, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].mpos, 200-1) )
++        self.assertEqual( self.reads[1].mpos, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].mpos, 500-1) )
++        self.assertEqual( self.reads[0].pnext, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].pnext, 200-1) )
++        self.assertEqual( self.reads[1].pnext, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].pnext, 500-1) )
++
++    def testARisize(self):
++        self.assertEqual( self.reads[0].isize, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].isize, 167) )
++        self.assertEqual( self.reads[1].isize, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].isize, 412) )
++        self.assertEqual( self.reads[0].tlen, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].tlen, 167) )
++        self.assertEqual( self.reads[1].tlen, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].tlen, 412) )
++
++    def testARseq(self):
++        self.assertEqual( self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 1: %s != %s" % (self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
++        self.assertEqual( self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "sequence size mismatch in read 2: %s != %s" % (self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") )
++        self.assertEqual( self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 4: %s != %s" % (self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
++
++    def testARqual(self):
++        self.assertEqual( self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 1: %s != %s" % (self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
++        self.assertEqual( self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "quality string mismatch in read 2: %s != %s" % (self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") )
++        self.assertEqual( self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 3: %s != %s" % (self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
++
++    def testARquery(self):
++        self.assertEqual( self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "query mismatch in read 1: %s != %s" % (self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") )
++        self.assertEqual( self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "query size mismatch in read 2: %s != %s" % (self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") )
++        self.assertEqual( self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT", "query mismatch in read 4: %s != %s" % (self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT") )
++
++    def testARqqual(self):
++        self.assertEqual( self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "qquality string mismatch in read 1: %s != %s" % (self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") )
++        self.assertEqual( self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "qquality string mismatch in read 2: %s != %s" % (self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") )
++        self.assertEqual( self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22", "qquality string mismatch in read 3: %s != %s" % (self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22") )
++
++    def testPresentOptionalFields(self):
++        self.assertEqual( self.reads[0].opt('NM'), 1, "optional field mismatch in read 1, NM: %s != %s" % (self.reads[0].opt('NM'), 1) )
++        self.assertEqual( self.reads[0].opt('RG'), 'L1', "optional field mismatch in read 1, RG: %s != %s" % (self.reads[0].opt('RG'), 'L1') )
++        self.assertEqual( self.reads[1].opt('RG'), 'L2', "optional field mismatch in read 2, RG: %s != %s" % (self.reads[1].opt('RG'), 'L2') )
++        self.assertEqual( self.reads[1].opt('MF'), 18, "optional field mismatch in read 2, MF: %s != %s" % (self.reads[1].opt('MF'), 18) )
++
++    def testPairedBools(self):
++        self.assertEqual( self.reads[0].is_paired, True, "is paired mismatch in read 1: %s != %s" % (self.reads[0].is_paired, True) )
++        self.assertEqual( self.reads[1].is_paired, True, "is paired mismatch in read 2: %s != %s" % (self.reads[1].is_paired, True) )
++        self.assertEqual( self.reads[0].is_proper_pair, True, "is proper pair mismatch in read 1: %s != %s" % (self.reads[0].is_proper_pair, True) )
++        self.assertEqual( self.reads[1].is_proper_pair, True, "is proper pair mismatch in read 2: %s != %s" % (self.reads[1].is_proper_pair, True) )
++
++    def testTags( self ):
++        self.assertEqual( self.reads[0].tags, 
++                          [('NM', 1), ('RG', 'L1'), 
++                           ('PG', 'P1'), ('XT', 'U')] )
++        self.assertEqual( self.reads[1].tags, 
++                          [('MF', 18), ('RG', 'L2'), 
++                           ('PG', 'P2'),('XT', 'R') ] )
++
++    def testOpt( self ):
++        self.assertEqual( self.reads[0].opt("XT"), "U" )
++        self.assertEqual( self.reads[1].opt("XT"), "R" )
++
++    def testMissingOpt( self ):
++        self.assertRaises( KeyError, self.reads[0].opt, "XP" )
++
++    def testEmptyOpt( self ):
++        self.assertRaises( KeyError, self.reads[2].opt, "XT" )
++
++    def tearDown(self):
++        self.samfile.close()
++
++class TestAlignedReadFromSam(TestAlignedReadFromBam):
++
++    def setUp(self):
++        self.samfile=pysam.Samfile( "ex3.sam","r" )
++        self.reads=list(self.samfile.fetch())
++
++# needs to be implemented 
++# class TestAlignedReadFromSamWithoutHeader(TestAlignedReadFromBam):
++#
++#     def setUp(self):
++#         self.samfile=pysam.Samfile( "ex7.sam","r" )
++#         self.reads=list(self.samfile.fetch())
++
++class TestHeaderSam(unittest.TestCase):
++
++    header = {'SQ': [{'LN': 1575, 'SN': 'chr1'}, 
++                     {'LN': 1584, 'SN': 'chr2'}], 
++              'RG': [{'LB': 'SC_1', 'ID': 'L1', 'SM': 'NA12891', 'PU': 'SC_1_10', "CN":"name:with:colon"}, 
++                     {'LB': 'SC_2', 'ID': 'L2', 'SM': 'NA12891', 'PU': 'SC_2_12', "CN":"name:with:colon"}],
++              'PG': [{'ID': 'P1', 'VN': '1.0'}, {'ID': 'P2', 'VN': '1.1'}], 
++              'HD': {'VN': '1.0'},
++              'CO' : [ 'this is a comment', 'this is another comment'],
++              }
++
++    def compareHeaders( self, a, b ):
++        '''compare two headers a and b.'''
++        for ak,av in a.items():
++            self.assertTrue( ak in b, "key '%s' not in '%s' " % (ak,b) )
++            self.assertEqual( av, b[ak] )
++
++    def setUp(self):
++        self.samfile=pysam.Samfile( "ex3.sam","r" )
++
++    def testHeaders(self):
++        self.compareHeaders( self.header, self.samfile.header )
++        self.compareHeaders( self.samfile.header, self.header )
++
++    def testNameMapping( self ):
++        for x, y in enumerate( ("chr1", "chr2")):
++            tid = self.samfile.gettid( y )
++            ref = self.samfile.getrname( x )
++            self.assertEqual( tid, x )
++            self.assertEqual( ref, y )
++
++        self.assertEqual( self.samfile.gettid("chr?"), -1 )
++        self.assertRaises( ValueError, self.samfile.getrname, 2 )
++
++    def tearDown(self):
++        self.samfile.close()
++
++class TestHeaderBam(TestHeaderSam):
++
++    def setUp(self):
++        self.samfile=pysam.Samfile( "ex3.bam","rb" )
++
++
++class TestHeader1000Genomes( unittest.TestCase ):
++
++    # bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase2b_alignment/data/NA07048/exome_alignment/NA07048.unmapped.ILLUMINA.bwa.CEU.exome.20120522_p2b.bam"
++    bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase3_EX_or_LC_only_alignment/data/HG00104/alignment/HG00104.chrom11.ILLUMINA.bwa.GBR.low_coverage.20130415.bam"
++        
++    def testRead( self ):
++
++      # Skip fetching files from web when building the package
++        #f = pysam.Samfile( self.bamfile, "rb" )
++        #data = f.header.copy()
++        #self.assertTrue( data )
++        self.assertTrue( True )
++
++class TestUnmappedReads(unittest.TestCase):
++
++    def testSAM(self):
++        samfile=pysam.Samfile( "ex5.sam","r" )
++        self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 ) 
++        samfile.close()
++
++    def testBAM(self):
++        samfile=pysam.Samfile( "ex5.bam","rb" )
++        self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 ) 
++        samfile.close()
++
++class TestPileupObjects(unittest.TestCase):
++
++    def setUp(self):
++        self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++    def testPileupColumn(self):
++        for pcolumn1 in self.samfile.pileup( region="chr1:105" ):
++            if pcolumn1.pos == 104:
++                self.assertEqual( pcolumn1.tid, 0, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn1.tid, 0) )
++                self.assertEqual( pcolumn1.pos, 105-1, "position mismatch in position 1: %s != %s" % (pcolumn1.pos, 105-1) )
++                self.assertEqual( pcolumn1.n, 2, "# reads mismatch in position 1: %s != %s" % (pcolumn1.n, 2) )
++        for pcolumn2 in self.samfile.pileup( region="chr2:1480" ):
++            if pcolumn2.pos == 1479:
++                self.assertEqual( pcolumn2.tid, 1, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn2.tid, 1) )
++                self.assertEqual( pcolumn2.pos, 1480-1, "position mismatch in position 1: %s != %s" % (pcolumn2.pos, 1480-1) )
++                self.assertEqual( pcolumn2.n, 12, "# reads mismatch in position 1: %s != %s" % (pcolumn2.n, 12) )
++
++    def testPileupRead(self):
++        for pcolumn1 in self.samfile.pileup( region="chr1:105" ):
++            if pcolumn1.pos == 104:
++                self.assertEqual( len(pcolumn1.pileups), 2, "# reads aligned to column mismatch in position 1: %s != %s" % (len(pcolumn1.pileups), 2) )
++#                self.assertEqual( pcolumn1.pileups[0]  # need to test additional properties here
++
++    def tearDown(self):
++        self.samfile.close()
++
++    def testIteratorOutOfScope( self ):
++        '''test if exception is raised if pileup col is accessed after iterator is exhausted.'''
++
++        for pileupcol in self.samfile.pileup():
++            pass
++        
++        self.assertRaises( ValueError, getattr, pileupcol, "pileups" )
++
++class TestContextManager(unittest.TestCase):
++
++    def testManager( self ):
++        with pysam.Samfile('ex1.bam', 'rb') as samfile:
++            samfile.fetch()
++        self.assertEqual( samfile._isOpen(), False )
++
++class TestExceptions(unittest.TestCase):
++
++    def setUp(self):
++        self.samfile=pysam.Samfile( "ex1.bam","rb" )
++
++    def testMissingFile(self):
++
++        self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "rb" )
++        self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "r" )
++        self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "r" )
++        self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "rb" )
++
++    def testBadContig(self):
++        self.assertRaises( ValueError, self.samfile.fetch, "chr88" )
++
++    def testMeaninglessCrap(self):
++        self.assertRaises( ValueError, self.samfile.fetch, "skljf" )
++
++    def testBackwardsOrderNewFormat(self):
++        self.assertRaises( ValueError, self.samfile.fetch, 'chr1', 100, 10 )
++
++    def testBackwardsOrderOldFormat(self):
++        self.assertRaises( ValueError, self.samfile.fetch, region="chr1:100-10")
++        
++    def testOutOfRangeNegativeNewFormat(self):
++        self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, -10 )
++        self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, 0 )
++        self.assertRaises( ValueError, self.samfile.fetch, "chr1", -5, -10 )
++
++        self.assertRaises( ValueError, self.samfile.count, "chr1", 5, -10 )
++        self.assertRaises( ValueError, self.samfile.count, "chr1", 5, 0 )        
++        self.assertRaises( ValueError, self.samfile.count, "chr1", -5, -10 )
++
++    def testOutOfRangeNegativeOldFormat(self):
++        self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-10" )
++        self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-0" )
++        self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5--10" )
++
++        self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-10" )
++        self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-0" )
++        self.assertRaises( ValueError, self.samfile.count, region="chr1:-5--10" )
++
++    def testOutOfRangNewFormat(self):
++        self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999, 99999999999 )
++        self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999, 99999999999 )
++
++    def testOutOfRangeLargeNewFormat(self):
++        self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 )
++        self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 )
++
++    def testOutOfRangeLargeOldFormat(self):
++        self.assertRaises( ValueError, self.samfile.fetch, "chr1:99999999999999999-999999999999999999" )
++        self.assertRaises( ValueError, self.samfile.count, "chr1:99999999999999999-999999999999999999" )
++
++    def testZeroToZero(self):        
++        '''see issue 44'''
++        self.assertEqual( len(list(self.samfile.fetch('chr1', 0, 0))), 0)
++
++    def tearDown(self):
++        self.samfile.close()
++
++class TestWrongFormat(unittest.TestCase):
++    '''test cases for opening files not in bam/sam format.'''
++
++    def testOpenSamAsBam( self ):
++        self.assertRaises( ValueError, pysam.Samfile, 'ex1.sam', 'rb' )
++
++    def testOpenBamAsSam( self ):
++        # test fails, needs to be implemented.
++        # sam.fetch() fails on reading, not on opening
++        # self.assertRaises( ValueError, pysam.Samfile, 'ex1.bam', 'r' )
++        pass
++
++    def testOpenFastaAsSam( self ):
++        # test fails, needs to be implemented.
++        # sam.fetch() fails on reading, not on opening
++        # self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'r' )
++        pass
++
++    def testOpenFastaAsBam( self ):
++        self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'rb' )
++
++class TestFastaFile(unittest.TestCase):
++
++    mSequences = { 'chr1' :
++                       b"CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGGGAGCTGTGGACCCTGCAGCCTGGCTGTGGGGGCCGCAGTGGCTGAGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCACAGGGGCTTAACCTCTGGTGACTGCCAGAGCTGCTGGCAAGCTAGAGTCCCATTTGGAGCCCCTCTAAGCCGTTCTATTTGTAATGAAAACTATATTTATGCTATTCAGTTCTAAATATAGAAATTGAAACAGCTGTGTTTAGTGCCTTTGTTCAACCCCCTTGCAACAACCTTGAGAACCCCAGGGAATTTGTCAATGTCAGGGAAGGAGCATTTTGTCAGTTACCAAATGTGTTTATTACCAGAGGGATGGAGGGAAGAGGGACGCTGAAGAACTTTGATGCCCTCTTCTTCCAAAGATGAAACGCGTAACTGCGCTCTCATTCACTCCAGCTCCCTGTCACCCAATGGACCTGTGATATCTGGATTCTGGGAAATTCTTCATCCTGGACCCTGAGAGATTCTGCAGCCCAGCTCCAGATTGCTTGTGGTCTGACAGGCTGCAACTGTGAGCCATCACAATGAACAACAGGAAGAAAAGGTCTTTCAAAAGGTGATGTGTGTTCTCATCAACCTCATACACACACATGGTTTAGGGGTATAATACCTCTACATGGCTGATTATGAAAACAATGTTCCCCAGATACCATCCCTGTCTTACTTCCAGCTCCCCAGAGGGAAAGCTTTCAACGCTTCTAGCCATTTCTTTTGGCATTTGCCTTCAGACCCTACACGAATGCGTCTCTACCACAGGGGGCTGCGCGGTTTCCCATCATGAAGCACTGAACTTCCACGTCTCATCTAGGGGAACAGGGAGGTGCACTAATGCGCTCCACGCCCAAGCCCTTCTCACAGTTTCTGCCCCCAGCATGGTTGTACTGGGCAATACATGAGATTATTAGGAAATGCTTTACTGTCATAACTATGAAGAGACTATTGCCAGATGAACCACACATTAATACTATGTTTCTTATCTGCACATTACTACCCTGCAATTAATATAATTGTGTCCATGTACACACGCTGTCCTATGTACTTATCATGACTCTATCCCAAATTCCCAATTACGTCCTATCTTCTTCTTAGGGAAGAACAGCTTAGGTATCAATTTGGTGTTCTGTGTAAAGTCTCAGGGAGCCGTCCGTGTCCTCCCATCTGGCCTCGTCCACACTGGTTCTCTTGAAAGCTTGGGCTGTAATGATGCCCCTTGGCCATCACCCAGTCCCTGCCCCATCTCTTGTAATCTCTCTCCTTTTTGCTGCATCCCTGTCTTCCTCTGTCTTGATTTACTTGTTGTTGGTTTTCTGTTTCTTTGTTTGATTTGGTGGAAGACATAATCCCACGCTTCCTATGGAAAGGTTGTTGGGAGATTTTTAATGATTCCTCAATGTTAAAATGTCTATTTTTGTCTTGACACCCAACTAATATTTGTCTGAGCAAAACAGTCTAGATGAGAGAGAACTTCCCTGGAGGTCTGATGGCGTTTCTCCCTCGTCTTCTTA",
++                   'chr2' :
++                       b"TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAAGAAATTACAAAATATAGTTGAAAGCTCTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCTTATGAATTAACCCAGTCAGACAAAAATAAAGAAAAAAATTTTAAAAATGAACAGAGCTTTCAAGAAGTATGAGATTATGTAAAGTAACTGAACCTATGAGTCACAGGTATTCCTGAGGAAAAAGAAAAAGTGAGAAGTTTGGAAAAACTATTTGAGGAAGTAATTGGGGAAAACCTCTTTAGTCTTGCTAGAGATTTAGACATCTAAATGAAAGAGGCTCAAAGAATGCCAGGAAGATACATTGCAAGACAGACTTCATCAAGATATGTAGTCATCAGACTATCTAAAGTCAACATGAAGGAAAAAAATTCTAAAATCAGCAAGAGAAAAGCATACAGTCATCTATAAAGGAAATCCCATCAGAATAACAATGGGCTTCTCAGCAGAAACCTTACAAGCCAGAAGAGATTGGATCTAATTTTTGGACTTCTTAAAGAAAAAAAAACCTGTCAAACACGAATGTTATGCCCTGCTAAACTAAGCATCATAAATGAAGGGGAAATAAAGTCAAGTCTTTCCTGACAAGCAAATGCTAAGATAATTCATCATCACTAAACCAGTCCTATAAGAAATGCTCAAAAGAATTGTAAAAGTCAAAATTAAAGTTCAATACTCACCATCATAAATACACACAAAAGTACAAAACTCACAGGTTTTATAAAACAATTGAGACTACAGAGCAACTAGGTAAAAAATTAACATTACAACAGGAACAAAACCTCATATATCAATATTAACTTTGAATAAAAAGGGATTAAATTCCCCCACTTAAGAGATATAGATTGGCAGAACAGATTTAAAAACATGAACTAACTATATGCTGTTTACAAGAAACTCATTAATAAAGACATGAGTTCAGGTAAAGGGGTGGAAAAAGATGTTCTACGCAAACAGAAACCAAATGAGAGAAGGAGTAGCTATACTTATATCAGATAAAGCACACTTTAAATCAACAACAGTAAAATAAAACAAAGGAGGTCATCATACAATGATAAAAAGATCAATTCAGCAAGAAGATATAACCATCCTACTAAATACATATGCACCTAACACAAGACTACCCAGATTCATAAAACAAATACTACTAGACCTAAGAGGGATGAGAAATTACCTAATTGGTACAATGTACAATATTCTGATGATGGTTACACTAAAAGCCCATACTTTACTGCTACTCAATATATCCATGTAACAAATCTGCGCTTGTACTTCTAAATCTATAAAAAAATTAAAATTTAACAAAAGTAAATAAAACACATAGCTAAAACTAAAAAAGCAAAAACAAAAACTATGCTAAGTATTGGTAAAGATGTGGGGAAAAAAGTAAACTCTCAAATATTGCTAGTGGGAGTATAAATTGTTTTCCACTTTGGAAAACAATTTGGTAATTTCGTTTTTTTTTTTTTCTTTTCTCTTTTTTTTTTTTTTTTTTTTGCATGCCAGAAAAAAATATTTACAGTAACT",
++                   }
++
++    def setUp(self):
++        self.file=pysam.Fastafile( "ex1.fa" )
++
++    def testFetch(self):
++        for id, seq in list(self.mSequences.items()):
++            self.assertEqual( seq, self.file.fetch( id ) )
++            for x in range( 0, len(seq), 10):
++                self.assertEqual( seq[x:x+10], self.file.fetch( id, x, x+10) )
++                # test x:end
++                self.assertEqual( seq[x:], self.file.fetch( id, x) )
++                # test 0:x
++                self.assertEqual( seq[:x], self.file.fetch( id, None, x) )
++
++        
++        # unknown sequence returns ""
++        self.assertEqual( b"", self.file.fetch("chr12") )
++
++    def testOutOfRangeAccess( self ):
++        '''test out of range access.'''
++        # out of range access returns an empty string
++        for contig, s in self.mSequences.items():
++            self.assertEqual( self.file.fetch( contig, len(s), len(s)+1), b"" )
++
++        self.assertEqual( self.file.fetch( "chr3", 0 , 100), b"" ) 
++
++    def testFetchErrors( self ):
++        self.assertRaises( ValueError, self.file.fetch )
++        self.assertRaises( ValueError, self.file.fetch, "chr1", -1, 10 )
++        self.assertRaises( ValueError, self.file.fetch, "chr1", 20, 10 )
++
++    def testLength( self ):
++        self.assertEqual( len(self.file), 2 )
++        
++    def tearDown(self):
++        self.file.close()
++
++class TestAlignedRead(unittest.TestCase):
++    '''tests to check if aligned read can be constructed
++    and manipulated.
++    '''
++
++    def checkFieldEqual( self, read1, read2, exclude = []):
++        '''check if two reads are equal by comparing each field.'''
++
++        for x in ("qname", "seq", "flag",
++                  "rname", "pos", "mapq", "cigar",
++                  "mrnm", "mpos", "isize", "qual",
++                  "is_paired", "is_proper_pair",
++                  "is_unmapped", "mate_is_unmapped",
++                  "is_reverse", "mate_is_reverse",
++                  "is_read1", "is_read2",
++                  "is_secondary", "is_qcfail",
++                  "is_duplicate", "bin"):
++            if x in exclude: continue
++            self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" % 
++                              (x, getattr(read1, x), getattr(read2,x)))
++    
++    def testEmpty( self ):
++        a = pysam.AlignedRead()
++        self.assertEqual( a.qname, None )
++        self.assertEqual( a.seq, None )
++        self.assertEqual( a.qual, None )
++        self.assertEqual( a.flag, 0 )
++        self.assertEqual( a.rname, 0 )
++        self.assertEqual( a.mapq, 0 )
++        self.assertEqual( a.cigar, None )
++        self.assertEqual( a.tags, [] )
++        self.assertEqual( a.mrnm, 0 )
++        self.assertEqual( a.mpos, 0 )
++        self.assertEqual( a.isize, 0 )
++
++    def buildRead( self ):
++        '''build an example read.'''
++        
++        a = pysam.AlignedRead()
++        a.qname = "read_12345"
++        a.seq="ACGT" * 10
++        a.flag = 0
++        a.rname = 0
++        a.pos = 20
++        a.mapq = 20
++        a.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) )
++        a.mrnm = 0
++        a.mpos=200
++        a.isize=167
++        a.qual="1234" * 10
++        # todo: create tags
++        return a
++
++    def testUpdate( self ):
++        '''check if updating fields affects other variable length data
++        '''
++        a = self.buildRead()
++        b = self.buildRead()
++
++        # check qname
++        b.qname = "read_123"
++        self.checkFieldEqual( a, b, "qname" )
++        b.qname = "read_12345678"
++        self.checkFieldEqual( a, b, "qname" )
++        b.qname = "read_12345"
++        self.checkFieldEqual( a, b)
++
++        # check cigar
++        b.cigar = ( (0,10), )
++        self.checkFieldEqual( a, b, "cigar" )
++        b.cigar = ( (0,10), (2,1), (0,10) )
++        self.checkFieldEqual( a, b, "cigar" )
++        b.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) )
++        self.checkFieldEqual( a, b)
++
++        # check seq 
++        b.seq = "ACGT"
++        self.checkFieldEqual( a, b, ("seq", "qual") )
++        b.seq = "ACGT" * 3
++        self.checkFieldEqual( a, b, ("seq", "qual") )
++        b.seq = "ACGT" * 10
++        self.checkFieldEqual( a, b, ("qual",))
++
++        # reset qual
++        b = self.buildRead()
++
++        # check flags:
++        for x in (
++            "is_paired", "is_proper_pair",
++            "is_unmapped", "mate_is_unmapped",
++            "is_reverse", "mate_is_reverse",
++            "is_read1", "is_read2",
++            "is_secondary", "is_qcfail",
++            "is_duplicate"):
++            setattr( b, x, True )
++            self.assertEqual( getattr(b, x), True )
++            self.checkFieldEqual( a, b, ("flag", x,) )
++            setattr( b, x, False )
++            self.assertEqual( getattr(b, x), False )
++            self.checkFieldEqual( a, b )
++
++    def testLargeRead( self ):
++        '''build an example read.'''
++        
++        a = pysam.AlignedRead()
++        a.qname = "read_12345"
++        a.seq="ACGT" * 200
++        a.flag = 0
++        a.rname = 0
++        a.pos = 20
++        a.mapq = 20
++        a.cigar = ( (0, 4 * 200), )
++        a.mrnm = 0
++        a.mpos=200
++        a.isize=167
++        a.qual="1234" * 200
++
++        return a
++
++    def testTagParsing( self ):
++        '''test for tag parsing
++
++        see http://groups.google.com/group/pysam-user-group/browse_thread/thread/67ca204059ea465a
++        '''
++        samfile=pysam.Samfile( "ex8.bam","rb" )
++
++        for entry in samfile:
++            before = entry.tags
++            entry.tags = entry.tags
++            after = entry.tags
++            self.assertEqual( after, before )
++
++    def testUpdateTlen( self ):
++        '''check if updating tlen works'''
++        a = self.buildRead()
++        oldlen = a.tlen
++        oldlen *= 2
++        a.tlen = oldlen
++        self.assertEqual( a.tlen, oldlen )
++
++    def testPositions( self ):
++        a = self.buildRead()
++        self.assertEqual( a.positions,
++                          [20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 
++                                31, 32, 33, 34, 35, 36, 37, 38, 39, 
++                           40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 
++                           50, 51, 52, 53, 54, 55, 56, 57, 58, 59] )
++
++        self.assertEqual( a.aligned_pairs,
++                          [(0, 20), (1, 21), (2, 22), (3, 23), (4, 24), 
++                           (5, 25), (6, 26), (7, 27), (8, 28), (9, 29), 
++                           (None, 30), 
++                           (10, 31), (11, 32), (12, 33), (13, 34), (14, 35), 
++                           (15, 36), (16, 37), (17, 38), (18, 39), (19, None), 
++                           (20, 40), (21, 41), (22, 42), (23, 43), (24, 44), 
++                           (25, 45), (26, 46), (27, 47), (28, 48), (29, 49), 
++                           (30, 50), (31, 51), (32, 52), (33, 53), (34, 54), 
++                           (35, 55), (36, 56), (37, 57), (38, 58), (39, 59)] )
++
++        self.assertEqual( a.positions, [x[1] for x in a.aligned_pairs if x[0] != None and x[1] != None] )
++        # alen is the length of the aligned read in genome
++        self.assertEqual( a.alen, a.aligned_pairs[-1][0] + 1 )
++        # aend points to one beyond last aligned base in ref
++        self.assertEqual( a.positions[-1], a.aend - 1 )
++
++class TestDeNovoConstruction(unittest.TestCase):
++    '''check BAM/SAM file construction using ex6.sam
++    
++    (note these are +1 coordinates):
++    
++    read_28833_29006_6945     99      chr1    33      20      10M1D25M        =       200     167     AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG     <<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<     NM:i:1  RG:Z:L1
++    read_28701_28881_323b     147     chr2    88      30      35M     =       500     412     ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA     <<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<     MF:i:18 RG:Z:L2
++    '''
++
++    header = { 'HD': {'VN': '1.0'},
++               'SQ': [{'LN': 1575, 'SN': 'chr1'}, 
++                      {'LN': 1584, 'SN': 'chr2'}], }
++
++    bamfile = "ex6.bam"
++    samfile = "ex6.sam"
++
++    def checkFieldEqual( self, read1, read2, exclude = []):
++        '''check if two reads are equal by comparing each field.'''
++
++        for x in ("qname", "seq", "flag",
++                  "rname", "pos", "mapq", "cigar",
++                  "mrnm", "mpos", "isize", "qual",
++                  "bin",
++                  "is_paired", "is_proper_pair",
++                  "is_unmapped", "mate_is_unmapped",
++                  "is_reverse", "mate_is_reverse",
++                  "is_read1", "is_read2",
++                  "is_secondary", "is_qcfail",
++                  "is_duplicate"):
++            if x in exclude: continue
++            self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" % 
++                              (x, getattr(read1, x), getattr(read2,x)))
++
++    def setUp( self ):
++
++        a = pysam.AlignedRead()
++        a.qname = "read_28833_29006_6945"
++        a.seq="AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG"
++        a.flag = 99
++        a.rname = 0
++        a.pos = 32
++        a.mapq = 20
++        a.cigar = ( (0,10), (2,1), (0,25) )
++        a.mrnm = 0
++        a.mpos=199
++        a.isize=167
++        a.qual="<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<"
++        a.tags = ( ("NM", 1),
++                   ("RG", "L1") )
++
++        b = pysam.AlignedRead()
++        b.qname = "read_28701_28881_323b"
++        b.seq="ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA"
++        b.flag = 147
++        b.rname = 1
++        b.pos = 87
++        b.mapq = 30
++        b.cigar = ( (0,35), )
++        b.mrnm = 1
++        b.mpos=499
++        b.isize=412
++        b.qual="<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<"
++        b.tags = ( ("MF", 18),
++                   ("RG", "L2") )
++
++        self.reads = (a,b)
++
++    def testSAMWholeFile( self ):
++        
++        tmpfilename = "tmp_%i.sam" % id(self)
++
++        outfile = pysam.Samfile( tmpfilename, "wh", header = self.header )
++
++        for x in self.reads: outfile.write( x )
++        outfile.close()
++        self.assertTrue( checkBinaryEqual( tmpfilename, self.samfile ),
++                         "mismatch when construction SAM file, see %s %s" % (tmpfilename, self.samfile))
++        
++        os.unlink( tmpfilename )
++
++    def testBAMPerRead( self ):
++        '''check if individual reads are binary equal.'''
++        infile = pysam.Samfile( self.bamfile, "rb")
++
++        others = list(infile)
++        for denovo, other in zip( others, self.reads):
++            self.checkFieldEqual( other, denovo )
++            self.assertEqual( other.compare( denovo ), 0 )
++
++    def testSAMPerRead( self ):
++        '''check if individual reads are binary equal.'''
++        infile = pysam.Samfile( self.samfile, "r")
++
++        others = list(infile)
++        for denovo, other in zip( others, self.reads):
++            self.checkFieldEqual( other, denovo )
++            self.assertEqual( other.compare( denovo), 0 )
++            
++    def testBAMWholeFile( self ):
++        
++        tmpfilename = "tmp_%i.bam" % id(self)
++
++        outfile = pysam.Samfile( tmpfilename, "wb", header = self.header )
++
++        for x in self.reads: outfile.write( x )
++        outfile.close()
++        
++        self.assertTrue( checkBinaryEqual( tmpfilename, self.bamfile ),
++                         "mismatch when construction BAM file, see %s %s" % (tmpfilename, self.bamfile))
++        
++        os.unlink( tmpfilename )
++
++class TestDeNovoConstructionUserTags(TestDeNovoConstruction):
++    '''test de novo construction with a header that contains lower-case tags.'''
++
++    header = { 'HD': {'VN': '1.0'},
++               'SQ': [{'LN': 1575, 'SN': 'chr1'}, 
++                      {'LN': 1584, 'SN': 'chr2'}],
++               'x1': {'A': 2, 'B': 5 },
++               'x3': {'A': 6, 'B': 5 },
++               'x2': {'A': 4, 'B': 5 } }
++
++    bamfile = "example_user_header.bam"
++    samfile = "example_user_header.sam"
++
++class TestEmptyHeader( unittest.TestCase ):
++    '''see issue 84.'''
++    
++    def testEmptyHeader( self ):
++
++        s = pysam.Samfile('example_empty_header.bam')
++        self.assertEqual( s.header, {'SQ': [{'LN': 1000, 'SN': 'chr1'}]} )
++
++class TestBTagSam( unittest.TestCase ):
++    '''see issue 81.'''
++    
++    compare = [ [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95],
++                [-100,200,-300,-400],
++                [-100,12],
++                [12,15],
++                [-1.0,5.0,2.5] ]
++            
++    filename = 'example_btag.sam'
++
++    def testRead( self ):
++
++        s = pysam.Samfile(self.filename)
++        for x, read in enumerate(s):
++            if x == 0:
++                self.assertEqual( read.tags, [('RG', 'QW85I'), ('PG', 'tmap'), ('MD', '140'), ('NM', 0), ('AS', 140), ('FZ', [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95]), ('XA', 'map2-1'), ('XS', 53), ('XT', 38), ('XF', 1), ('XE', 0)] 
++                                  )
++                         
++            fz = dict(read.tags)["FZ"]
++            self.assertEqual( fz, self.compare[x] )
++            self.assertEqual( read.opt("FZ"), self.compare[x])
++
++    def testWrite( self ):
++        
++        s = pysam.Samfile(self.filename)
++        for read in s:
++            before = read.tags
++            read.tags = read.tags
++            after = read.tags
++            self.assertEqual( after, before )
++
++class TestBTagBam( TestBTagSam ):
++    filename = 'example_btag.bam'
++
++class TestDoubleFetch(unittest.TestCase):
++    '''check if two iterators on the same bamfile are independent.'''
++    
++    def testDoubleFetch( self ):
++
++        samfile1 = pysam.Samfile('ex1.bam', 'rb')
++
++        for a,b in zip(samfile1.fetch(), samfile1.fetch()):
++            self.assertEqual( a.compare( b ), 0 )
++
++    def testDoubleFetchWithRegion( self ):
++
++        samfile1 = pysam.Samfile('ex1.bam', 'rb')
++        chr, start, stop = 'chr1', 200, 3000000
++        self.assertTrue(len(list(samfile1.fetch ( chr, start, stop))) > 0) #just making sure the test has something to catch
++
++        for a,b in zip(samfile1.fetch( chr, start, stop), samfile1.fetch( chr, start, stop)):
++            self.assertEqual( a.compare( b ), 0 ) 
++
++    def testDoubleFetchUntilEOF( self ):
++
++        samfile1 = pysam.Samfile('ex1.bam', 'rb')
++
++        for a,b in zip(samfile1.fetch( until_eof = True), 
++                       samfile1.fetch( until_eof = True )):
++            self.assertEqual( a.compare( b), 0 )
++
++class TestRemoteFileFTP(unittest.TestCase):
++    '''test remote access.
++
++    '''
++
++    # Need to find an ftp server without password on standard
++    # port.
++
++    url = "ftp://ftp.sanger.ac.uk/pub/rd/humanSequences/CV.bam"
++    region = "1:1-1000"
++
++    def testFTPView( self ):
++        return
++        result = pysam.view( self.url, self.region )
++        self.assertEqual( len(result), 36 )
++        
++    def testFTPFetch( self ):
++        return
++        samfile = pysam.Samfile(self.url, "rb")  
++        result = list(samfile.fetch( region = self.region ))
++        self.assertEqual( len(result), 36 )
++
++class TestLargeOptValues( unittest.TestCase ):
++
++    ints = ( 65536, 214748, 2147484, 2147483647 )
++    floats = ( 65536.0, 214748.0, 2147484.0 )
++
++    def check( self, samfile ):
++        
++        i = samfile.fetch()
++        for exp in self.ints:
++            rr = next(i)
++            obs = rr.opt("ZP")
++            self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++        for exp in [ -x for x in self.ints ]:
++            rr = next(i)
++            obs = rr.opt("ZP")
++            self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++        for exp in self.floats:
++            rr = next(i)
++            obs = rr.opt("ZP")
++            self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++        for exp in [ -x for x in self.floats ]:
++            rr = next(i)
++            obs = rr.opt("ZP")
++            self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr)))
++
++    def testSAM( self ):
++        samfile = pysam.Samfile("ex10.sam", "r")
++        self.check( samfile )
++
++    def testBAM( self ):
++        samfile = pysam.Samfile("ex10.bam", "rb")
++        self.check( samfile )
++
++# class TestSNPCalls( unittest.TestCase ):
++#     '''test pysam SNP calling ability.'''
++
++#     def checkEqual( self, a, b ):
++#         for x in ("reference_base", 
++#                   "pos",
++#                   "genotype",
++#                   "consensus_quality",
++#                   "snp_quality",
++#                   "mapping_quality",
++#                   "coverage" ):
++#             self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" % 
++#                               (x, getattr(a, x), getattr(b,x), str(a), str(b)))
++
++#     def testAllPositionsViaIterator( self ):
++#         samfile = pysam.Samfile( "ex1.bam", "rb")  
++#         fastafile = pysam.Fastafile( "ex1.fa" )
++#         try: 
++#             refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base != "*"]
++#         except pysam.SamtoolsError:
++#             pass
++
++#         i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++#         calls = list(pysam.IteratorSNPCalls(i))
++#         for x,y in zip( refs, calls ):
++#             self.checkEqual( x, y )
++
++#     def testPerPositionViaIterator( self ):
++#         # test pileup for each position. This is a slow operation
++#         # so this test is disabled 
++#         return
++#         samfile = pysam.Samfile( "ex1.bam", "rb")  
++#         fastafile = pysam.Fastafile( "ex1.fa" )
++#         for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
++#             if x.reference_base == "*": continue
++#             i = samfile.pileup( x.chromosome, x.pos, x.pos+1,
++#                                 fastafile = fastafile,
++#                                 stepper = "samtools" )
++#             z = [ zz for zz in pysam.IteratorSamtools(i) if zz.pos == x.pos ]
++#             self.assertEqual( len(z), 1 )
++#             self.checkEqual( x, z[0] )
++
++#     def testPerPositionViaCaller( self ):
++#         # test pileup for each position. This is a fast operation
++#         samfile = pysam.Samfile( "ex1.bam", "rb")  
++#         fastafile = pysam.Fastafile( "ex1.fa" )
++#         i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++#         caller = pysam.SNPCaller( i )
++
++#         for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
++#             if x.reference_base == "*": continue
++#             call = caller.call( x.chromosome, x.pos )
++#             self.checkEqual( x, call )
++
++# class TestIndelCalls( unittest.TestCase ):
++#     '''test pysam indel calling.'''
++
++#     def checkEqual( self, a, b ):
++
++#         for x in ("pos",
++#                   "genotype",
++#                   "consensus_quality",
++#                   "snp_quality",
++#                   "mapping_quality",
++#                   "coverage",
++#                   "first_allele",
++#                   "second_allele",
++#                   "reads_first",
++#                   "reads_second",
++#                   "reads_diff"):
++#             if b.genotype == "*/*" and x == "second_allele":
++#                 # ignore test for second allele (positions chr2:439 and chr2:1512)
++#                 continue
++#             self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" % 
++#                               (x, getattr(a, x), getattr(b,x), str(a), str(b)))
++
++#     def testAllPositionsViaIterator( self ):
++
++#         samfile = pysam.Samfile( "ex1.bam", "rb")  
++#         fastafile = pysam.Fastafile( "ex1.fa" )
++#         try: 
++#             refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base == "*"]
++#         except pysam.SamtoolsError:
++#             pass
++
++#         i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++#         calls = [ x for x in list(pysam.IteratorIndelCalls(i)) if x != None ]
++#         for x,y in zip( refs, calls ):
++#             self.checkEqual( x, y )
++
++#     def testPerPositionViaCaller( self ):
++#         # test pileup for each position. This is a fast operation
++#         samfile = pysam.Samfile( "ex1.bam", "rb")  
++#         fastafile = pysam.Fastafile( "ex1.fa" )
++#         i = samfile.pileup( stepper = "samtools", fastafile = fastafile )
++#         caller = pysam.IndelCaller( i )
++
++#         for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ):
++#             if x.reference_base != "*": continue
++#             call = caller.call( x.chromosome, x.pos )
++#             self.checkEqual( x, call )
++
++class TestLogging( unittest.TestCase ):
++    '''test around bug issue 42,
++
++    failed in versions < 0.4
++    '''
++
++    def check( self, bamfile, log ):
++
++        if log:
++            logger = logging.getLogger('franklin')
++            logger.setLevel(logging.INFO)
++            formatter = logging.Formatter('%(asctime)s %(levelname)s %(message)s')
++            log_hand  = logging.FileHandler('log.txt')
++            log_hand.setFormatter(formatter)
++            logger.addHandler(log_hand)
++
++        bam  = pysam.Samfile(bamfile, 'rb')
++        cols = bam.pileup()
++        self.assertTrue( True )
++
++    def testFail1( self ):
++        self.check( "ex9_fail.bam", False )
++        self.check( "ex9_fail.bam", True )
++
++    def testNoFail1( self ):
++        self.check( "ex9_nofail.bam", False )
++        self.check( "ex9_nofail.bam", True )
++
++    def testNoFail2( self ):
++        self.check( "ex9_nofail.bam", True )
++        self.check( "ex9_nofail.bam", True )
++        
++# TODOS
++# 1. finish testing all properties within pileup objects
++# 2. check exceptions and bad input problems (missing files, optional fields that aren't present, etc...)
++# 3. check: presence of sequence
++
++class TestSamfileUtilityFunctions( unittest.TestCase ):
++
++    def testCount( self ):
++
++        samfile = pysam.Samfile( "ex1.bam", "rb" )
++
++        for contig in ("chr1", "chr2" ):
++            for start in range( 0, 2000, 100 ):
++                end = start + 1
++                self.assertEqual( len( list( samfile.fetch( contig, start, end ) ) ),
++                                  samfile.count( contig, start, end ) )
++
++                # test empty intervals
++                self.assertEqual( len( list( samfile.fetch( contig, start, start ) ) ),
++                                  samfile.count( contig, start, start ) )
++
++                # test half empty intervals
++                self.assertEqual( len( list( samfile.fetch( contig, start ) ) ),
++                                  samfile.count( contig, start ) )
++
++    def testMate( self ):
++        '''test mate access.'''
++
++        with open( "ex1.sam", "rb" ) as inf:
++            readnames = [ x.split(b"\t")[0] for x in inf.readlines() ]
++        if sys.version_info[0] >= 3:
++            readnames = [ name.decode('ascii') for name in readnames ]
++            
++        counts = collections.defaultdict( int )
++        for x in readnames: counts[x] += 1
++
++        samfile = pysam.Samfile( "ex1.bam", "rb" )
++        for read in samfile.fetch():
++            if not read.is_paired:
++                self.assertRaises( ValueError, samfile.mate, read )
++            elif read.mate_is_unmapped:
++                self.assertRaises( ValueError, samfile.mate, read )
++            else:
++                if counts[read.qname] == 1:
++                    self.assertRaises( ValueError, samfile.mate, read )
++                else:
++                    mate = samfile.mate( read )
++                    self.assertEqual( read.qname, mate.qname )
++                    self.assertEqual( read.is_read1, mate.is_read2 )
++                    self.assertEqual( read.is_read2, mate.is_read1 )
++                    self.assertEqual( read.pos, mate.mpos )
++                    self.assertEqual( read.mpos, mate.pos )
++
++    def testIndexStats( self ):
++        '''test if total number of mapped/unmapped reads is correct.'''
++
++        samfile = pysam.Samfile( "ex1.bam", "rb" )
++        self.assertEqual( samfile.mapped, 3235 )
++        self.assertEqual( samfile.unmapped, 35 )
++
++class TestSamtoolsProxy( unittest.TestCase ):
++    '''tests for sanity checking access to samtools functions.'''
++
++    def testIndex( self ):
++        self.assertRaises( IOError, pysam.index, "missing_file" )
++
++    def testView( self ):
++        # note that view still echos "open: No such file or directory"
++        self.assertRaises( pysam.SamtoolsError, pysam.view, "missing_file" )
++
++    def testSort( self ):
++        self.assertRaises( pysam.SamtoolsError, pysam.sort, "missing_file" )
++
++class TestSamfileIndex( unittest.TestCase):
++    
++    def testIndex( self ):
++        samfile = pysam.Samfile( "ex1.bam", "rb" )
++        index = pysam.IndexedReads( samfile )
++        index.build()
++
++        reads = collections.defaultdict( int )
++
++        for read in samfile: reads[read.qname] += 1
++            
++        for qname, counts in reads.items():
++            found = list(index.find( qname ))
++            self.assertEqual( len(found), counts )
++            for x in found: self.assertEqual( x.qname, qname )
++            
++
++if __name__ == "__main__":
++    # build data files
++    print ("building data files")
++    subprocess.call( "make", shell=True)
++    print ("starting tests")
++    unittest.main()
++    print ("completed tests")
diff --git a/debian/patches/series b/debian/patches/series
new file mode 100644 (file)
index 0000000..ebb9930
--- /dev/null
@@ -0,0 +1,3 @@
+fix_cleanup_tests.patch
+do_not_use_distribute_setup.patch
+offline-tests.patch
diff --git a/debian/source/format b/debian/source/format
new file mode 100644 (file)
index 0000000..163aaf8
--- /dev/null
@@ -0,0 +1 @@
+3.0 (quilt)